View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13059_high_35 (Length: 206)

Name: NF13059_high_35
Description: NF13059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13059_high_35
NF13059_high_35
[»] chr2 (2 HSPs)
chr2 (134-188)||(21187196-21187250)
chr2 (16-55)||(21187157-21187196)


Alignment Details
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 134 - 188
Target Start/End: Original strand, 21187196 - 21187250
Alignment:
134 ggttactaggttttaccggtgggaaggttcgatgagatttagggggttgaaggtg 188  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
21187196 ggttactagattttaccggtgggaaggttcgatgagatttagggggttgaaggtg 21187250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 21187157 - 21187196
Alignment:
16 cagagaacagagggaagagagattcggatctgatacaaag 55  Q
    ||||||| ||||||||||||||||||||||||||||||||    
21187157 cagagaatagagggaagagagattcggatctgatacaaag 21187196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University