View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13059_low_12 (Length: 461)
Name: NF13059_low_12
Description: NF13059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13059_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 6e-75; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 273 - 435
Target Start/End: Original strand, 116510 - 116672
Alignment:
| Q |
273 |
acagatcatgtaacccagacgatgaattacttattactgtgttttttgagaccggattctcagtggtggctagcatatcaaacacctaagtcttattcga |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
116510 |
acagatcatgtaacccagacgatgaattacttattactgtgttttttgagaccaggttctcagtggtggctagcatatcaaacacctaagtcttattcga |
116609 |
T |
|
| Q |
373 |
ctgatatggatttacattgcccatcctgcttgattaatttcttccatttccgagttattctac |
435 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
116610 |
ctgatatggatttacattgctcatcctgcttgattaatttcttccctttccgagttgttctac |
116672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 197 - 243
Target Start/End: Original strand, 116287 - 116333
Alignment:
| Q |
197 |
aatcaattctaccatttgattcatgtcttcttctgttaggaatccac |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
116287 |
aatcaattctaccatttgattcatgtcttcttccgttagaaatccac |
116333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 243 - 275
Target Start/End: Original strand, 116423 - 116455
Alignment:
| Q |
243 |
cagctgaggtcattggtgtatcgagttcctaca |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
116423 |
cagctgaggtcattggtgtatcgagttcctaca |
116455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University