View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13059_low_22 (Length: 362)
Name: NF13059_low_22
Description: NF13059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13059_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 33751049 - 33751324
Alignment:
| Q |
1 |
gctatgtagaattttgctgtgcaatgtgcagctagctagtgtctttcttgcttcaactacnnnnnnncacgaacaaaattgccttgatatatacctgcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33751049 |
gctatgtagaattttgctgtgcaatgtgcagctag----tgtctttcttgcttcaactactttttttcacgaacaaaattgccttgatatatacctgcaa |
33751144 |
T |
 |
| Q |
101 |
gtgcaaatcgtgattttaatgtaatctgctttctaaaatattctacttaatgtgtggctttgttgaattatattatagtataaatactagttctgttcac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33751145 |
ctgcaaatcgtgattttaatgtaatctgctttctaaaatattgtacttaatgtgtggctttattgaattatattatagtataaatactagttctgttcac |
33751244 |
T |
 |
| Q |
201 |
tgattttgtctttttagcttaaagggttatatattcagcttcaatgagtacattgttttttaataaggataagaatataa |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33751245 |
tgattttgtctttttagcttaaagggttatatattcagcttcaatgagtgcattgttttttaataaggataagaatataa |
33751324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 91 - 119
Target Start/End: Original strand, 32575995 - 32576023
Alignment:
| Q |
91 |
atacctgcaagtgcaaatcgtgattttaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32575995 |
atacctgcaagtgcaaatcgtgattttaa |
32576023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University