View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13059_low_30 (Length: 278)
Name: NF13059_low_30
Description: NF13059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13059_low_30 |
 |  |
|
| [»] chr5 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 17 - 278
Target Start/End: Complemental strand, 7737486 - 7737225
Alignment:
| Q |
17 |
caagtccatcaccgcagaagccgtggaggagaaccactactggtttcgtgggtttggatatgggtttgggttttagtttggacttggaaatggtgttaga |
116 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7737486 |
caagtccatcaccgcagaagccatggaggagaaccactactggcttcgtgggtttggatatgggtttgggttttagtttggacttggaaatggtgttaga |
7737387 |
T |
 |
| Q |
117 |
aggaacccaaaatctcataactgttcctggttctatctctactgtgtggagctttaaacctgccatcttcactacccaactaaccaatgtccaaattacg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7737386 |
aggaacccaaaatctcataactgttcctggttctatctctactgtgtggagctttaaacctgccatcttcactacccaactaaccaatgtccaaattacg |
7737287 |
T |
 |
| Q |
217 |
ttcaccgtgttcaccatgtttgattatatttgtttgtgtctattgtgattgcactggctttc |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7737286 |
ttcaccgtgttcaccatgtttgattatatttgtttgtgtctattgtgattgcactggctttc |
7737225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 118 - 271
Target Start/End: Complemental strand, 7768255 - 7768105
Alignment:
| Q |
118 |
ggaacccaaaatctcataactgttcctggttctatctctactgtgtggagctttaaacctgccatcttcactacccaactaaccaatgtccaaattacgt |
217 |
Q |
| |
|
|||||||| ||||||||| ||| ||| | ||||||||||| |||| ||||| | |||| | |||||| ||||||| | |||| ||||||||||| |
|
|
| T |
7768255 |
ggaacccagaatctcatacgtgtaccttgctctatctctacggtgtaaagcttcacacctacattcttcatcgtccaactaccaaatgaccaaattacgt |
7768156 |
T |
 |
| Q |
218 |
tcaccgtgttcaccatgtttgattatatttgtttgtgtctattgtgattgcact |
271 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||| | ||||||||||||||||| |
|
|
| T |
7768155 |
tcaccatgttcaccatgtttaatta-atttgtt--tttctattgtgattgcact |
7768105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 59
Target Start/End: Complemental strand, 7768338 - 7768296
Alignment:
| Q |
17 |
caagtccatcaccgcagaagccgtggaggagaaccactactgg |
59 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7768338 |
caagtccatcgccgcagaagccgtggaggagaaccactactgg |
7768296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 33 - 155
Target Start/End: Complemental strand, 7748396 - 7748274
Alignment:
| Q |
33 |
gaagccgtggaggagaaccactactggtttcgtgggtttggatatgggtttgggttttagtttggacttggaaatggtgttagaaggaacccaaaatctc |
132 |
Q |
| |
|
||||||||| || |||||||||||||| || || ||||| || ||| | ||| |||| |||||| | | |||||||| | ||| |||||||||||| || |
|
|
| T |
7748396 |
gaagccgtgaagaagaaccactactggcttggtaggttttgaaatgtgcttgagtttgggtttgggcgttgaaatggtttcagatggaacccaaaatttc |
7748297 |
T |
 |
| Q |
133 |
ataactgttcctggttctatctc |
155 |
Q |
| |
|
|||||||| || || |||||||| |
|
|
| T |
7748296 |
ataactgtaccgggctctatctc |
7748274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University