View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13059_low_38 (Length: 206)
Name: NF13059_low_38
Description: NF13059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13059_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 134 - 188
Target Start/End: Original strand, 21187196 - 21187250
Alignment:
| Q |
134 |
ggttactaggttttaccggtgggaaggttcgatgagatttagggggttgaaggtg |
188 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21187196 |
ggttactagattttaccggtgggaaggttcgatgagatttagggggttgaaggtg |
21187250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 21187157 - 21187196
Alignment:
| Q |
16 |
cagagaacagagggaagagagattcggatctgatacaaag |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21187157 |
cagagaatagagggaagagagattcggatctgatacaaag |
21187196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University