View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_high_61 (Length: 314)
Name: NF1305_high_61
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_high_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 68 - 218
Target Start/End: Original strand, 33345960 - 33346107
Alignment:
| Q |
68 |
cacagagggaaagagagagtgtggtggttggtgttttctctgaaggtgtcactgtgtatgaatggtggatgtggatgttcaccannnnnnngttcttgtt |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| ||||||||||||||||| |||||||| |
|
|
| T |
33345960 |
cacagagggaaagagagagtgtggtggttggtgttttctctgaaggtgttactgtgtatgaacggtagatgtggatgttcaccatttttttgttcttgta |
33346059 |
T |
 |
| Q |
168 |
ctgtttggtgtgataaacccttgtattgtagtagaagcaaaatcctgttct |
218 |
Q |
| |
|
|||||||||||| || | |||||||||||||||||| |||||||||||| |
|
|
| T |
33346060 |
ctgtttggtgtggtata---ttgtattgtagtagaagccaaatcctgttct |
33346107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 70 - 114
Target Start/End: Original strand, 33334321 - 33334365
Alignment:
| Q |
70 |
cagagggaaagagagagtgtggtggttggtgttttctctgaaggt |
114 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||| |||||| |
|
|
| T |
33334321 |
cagagggaaagagagagtgtggtgcttggtgttgtctcggaaggt |
33334365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University