View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_high_64 (Length: 306)
Name: NF1305_high_64
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_high_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 9e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 17 - 96
Target Start/End: Original strand, 28451184 - 28451263
Alignment:
| Q |
17 |
aagaatatagaaacatgtctcaatgtgtttactttttcatgaaccacttgatgctttgctaagtctaatgcatacttact |
96 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28451184 |
aagaaaatagaaacatgtctcaatgtgtttactttttcatgagccacttgatgctttgctaagtctaatgcatacttact |
28451263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 95 - 159
Target Start/End: Original strand, 12748922 - 12748986
Alignment:
| Q |
95 |
ctatcaattagcaattacatcttctcaacttcctttagattcatttccaacataagcatgttgat |
159 |
Q |
| |
|
||||||||||| |||| ||||||||| |||| | ||| |||||||| | ||||||||||||||| |
|
|
| T |
12748922 |
ctatcaattagtaattccatcttctcttcttcttctagcttcatttctagcataagcatgttgat |
12748986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University