View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_high_69 (Length: 296)
Name: NF1305_high_69
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_high_69 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 52 - 233
Target Start/End: Original strand, 26031214 - 26031395
Alignment:
| Q |
52 |
accacagagaattgcagtcaaatgaaattaatgtggcttcaattgctgccgcgttatgttgctcagatcgcgtacacaaacctttgtttaaaaccttgat |
151 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26031214 |
accacagagaattgcaatcaaatgaaattaatgtggcttcaattgctgccgcgttatgttgctcagatcgcgtacacaaacctttgtttaaaaccttgat |
26031313 |
T |
|
| Q |
152 |
tactacactcctaatttgattttcttcatttgtttatatggttttgtgattgaatttatgattagaattgtcaaaattgctg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26031314 |
tactacactcctaatttgattttcttcatttgtttatatggttttgtgattgaatttatgattagaattgtcaaaattgctg |
26031395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University