View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1305_high_69 (Length: 296)

Name: NF1305_high_69
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1305_high_69
NF1305_high_69
[»] chr7 (1 HSPs)
chr7 (52-233)||(26031214-26031395)


Alignment Details
Target: chr7 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 52 - 233
Target Start/End: Original strand, 26031214 - 26031395
Alignment:
52 accacagagaattgcagtcaaatgaaattaatgtggcttcaattgctgccgcgttatgttgctcagatcgcgtacacaaacctttgtttaaaaccttgat 151  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26031214 accacagagaattgcaatcaaatgaaattaatgtggcttcaattgctgccgcgttatgttgctcagatcgcgtacacaaacctttgtttaaaaccttgat 26031313  T
152 tactacactcctaatttgattttcttcatttgtttatatggttttgtgattgaatttatgattagaattgtcaaaattgctg 233  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26031314 tactacactcctaatttgattttcttcatttgtttatatggttttgtgattgaatttatgattagaattgtcaaaattgctg 26031395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University