View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_high_89 (Length: 238)
Name: NF1305_high_89
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_high_89 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 39230487 - 39230250
Alignment:
| Q |
1 |
caattaaggtacatgtacttggttggcaaggtaggatggagtgatttgtgaaagccaaagaaactagtttataattggtctccaaccaaatataatcaca |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39230487 |
caattaaggtacatgttcttggttggcaaggtaggatggagtgacttgtgagagccaaagaaactagtttataattggtctccaaccaaatataatcaca |
39230388 |
T |
 |
| Q |
101 |
tcctcttattgtagcaatttcatttacaatcatggtacccaagagttttgccaatggagcagtagaaatacaaagcaactccatcaatgtttaactccat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39230387 |
tcctcttattgtagcaatttcatttacaatcatggtgccgaagagttttgccaatggagcagtagaaatacaaagcaactccatcaatgtttaactccat |
39230288 |
T |
 |
| Q |
201 |
caatattgccaatggagcagtgaagatatatgtgctag |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39230287 |
caatattgccaatggagcagtgaagatatatgtgctag |
39230250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University