View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_100 (Length: 311)
Name: NF1305_low_100
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_100 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 64 - 242
Target Start/End: Complemental strand, 42853621 - 42853443
Alignment:
| Q |
64 |
ggaggagcagagagtggaggagggtgtcttagttgagttgaacagtgaaaaactaattgtgaaggtaattattctattctaagggtacaaaaagagcaga |
163 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42853621 |
ggagaagcaaagagtggaggagggtgtcttagttgagttgaacagtgaaaaactaattgtgaaggtaattattctattctaagggtacaaaaagagcaga |
42853522 |
T |
 |
| Q |
164 |
gagaaagtgagtcaaaaggtacccacccttttgtaatctaaaatcccactcttgcgttaattttctctctttctctgtg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42853521 |
gagaaagtgagtcaaaaggtacccacccttttgtaatctaaaatcccactcttgtgttaattttctctctttctctgtg |
42853443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University