View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_105 (Length: 304)
Name: NF1305_low_105
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_105 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 39299022 - 39299171
Alignment:
| Q |
1 |
cctgaacaactgcagacttggctgtctccgccacaggggtagcatattctgttgcagtttttgcagcgcttgaaacagtgtcttttgttgcttcataacc |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299022 |
cctgaacaactgcagacttggctttctccgccacaggggtaacatattctgttgcagtttttgcagcgcttgaaacagtgtcttttgttgcttcataacc |
39299121 |
T |
|
| Q |
101 |
ttgttgtgttttctcaagagttgcatctttggcttgtgctgctttctcca |
150 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39299122 |
ttgttgtgttttctcaacagttgcatctttggcttgtgctgctttctcca |
39299171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University