View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_106 (Length: 304)
Name: NF1305_low_106
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_106 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 71 - 240
Target Start/End: Complemental strand, 37910290 - 37910121
Alignment:
| Q |
71 |
tccaaccttcgtcagcacatgcgccatgcatggagctaggtgtggtgcacgtactacatatgacaaccctaaacctcttgtcaaggagtgcagtgtgcgt |
170 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37910290 |
tccaactttcgtcagcacatgcgccatgcatggagctaggtgtggtgcacgtactacatacgacaaccctaaacctcttgtcaaagagtgcagtgtgcgt |
37910191 |
T |
|
| Q |
171 |
agaggtaaggatggtgtgcatcactagcaatcacaagaggccaacacattaatgaagatcatctgtggtg |
240 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
37910190 |
agaagtaaggatggtgtgcatcactagcaatcacaaaaggccaacacattaatgaagatcatttgtggtg |
37910121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University