View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_109 (Length: 301)
Name: NF1305_low_109
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_109 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 60 - 241
Target Start/End: Complemental strand, 39431774 - 39431593
Alignment:
| Q |
60 |
ccacagaggatgcaaaagaatttgctgagaaagaaggcttatttttcttagagacctctgcgctgcaagcaactaatgttgagacggccttcatgactgt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39431774 |
ccacagaggatgcaaaagaatttgctgagaaagaaggcttatttttcttagagacctctgcgctgcaagcaactaatgttgagacggccttcatgactgt |
39431675 |
T |
|
| Q |
160 |
tttgacagaaatatttaacattgtcaacaagaagaacctggctgctgatgagaatcagggaaatggcaactcagcatctctg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39431674 |
tttgacagaaatatttaacattgtcaacaagaagaacctggctgctgatgagaatcagggaaatggcaactcagcatctctg |
39431593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 111; Significance: 5e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 60 - 238
Target Start/End: Complemental strand, 37625233 - 37625055
Alignment:
| Q |
60 |
ccacagaggatgcaaaagaatttgctgagaaagaaggcttatttttcttagagacctctgcgctgcaagcaactaatgttgagacggccttcatgactgt |
159 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| | |||| ||||| || |
|
|
| T |
37625233 |
ccacagaggatgcaaaagagtttgctgagaaagaaggcttatttttcttagagacctcagcattgcaagcaactaatgttgaagcatcctttatgacagt |
37625134 |
T |
|
| Q |
160 |
tttgacagaaatatttaacattgtcaacaagaagaacctggctgctgatgagaatcagggaaatggcaactcagcatct |
238 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||| |
|
|
| T |
37625133 |
tttgacagaaatctacaacattgtcaacaagaagaacctagctgctgatgaaagtcagggaaatgggaactcagcatct |
37625055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University