View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_110 (Length: 301)
Name: NF1305_low_110
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_110 |
 | |
|
| [»] scaffold0421 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0421 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0421
Description:
Target: scaffold0421; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 92 - 158
Target Start/End: Original strand, 13270 - 13336
Alignment:
| Q |
92 |
aaaaagattcatgtaccactcttttggtacacccttttctaccaccaatgacatggcatggaaatat |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13270 |
aaaaagattcatgtaccactcttttggtacacccttttctaccaccgatgacatggcatggaaatat |
13336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 99 - 158
Target Start/End: Complemental strand, 47345551 - 47345492
Alignment:
| Q |
99 |
ttcatgtaccactcttttggtacacccttttctaccaccaatgacatggcatggaaatat |
158 |
Q |
| |
|
|||||||| ||||||||||||||||||||| || ||| |||||||| ||||||||||| |
|
|
| T |
47345551 |
ttcatgtattactcttttggtacacccttttatagcactgatgacatgacatggaaatat |
47345492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University