View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_118 (Length: 293)
Name: NF1305_low_118
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_118 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 61 - 241
Target Start/End: Complemental strand, 24295050 - 24294870
Alignment:
| Q |
61 |
attgtattgtattgtatgttatgttaggaaataataaatatatgcaacatagctataactttagtaatgtaatgtattttattgtatgtttggactgatg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
24295050 |
attgtattgtattgtatgttatgttaggaaataataaatatatgcaacatagctataactttagtactgtattgtattttattgtatgtttggactgatg |
24294951 |
T |
 |
| Q |
161 |
gaaagggatagagttttttgaacagtggaaagggatagagtggaatcatacattgtttggattgtgtcaaatgggtctgtg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24294950 |
gaaagggatagagttttttgaacagtggaaagggatagagtggaatcatacattgtttggattgtgtcaaatgggtctgtg |
24294870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University