View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1305_low_120 (Length: 292)

Name: NF1305_low_120
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1305_low_120
NF1305_low_120
[»] chr8 (2 HSPs)
chr8 (50-186)||(13079526-13079663)
chr8 (199-242)||(13079709-13079752)
[»] chr2 (1 HSPs)
chr2 (99-186)||(19340437-19340524)


Alignment Details
Target: chr8 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 50 - 186
Target Start/End: Original strand, 13079526 - 13079663
Alignment:
50 gagcagagagagttgaatgaaatgaaaaagcactcagnnnnnnnnnnnn-gagattgattcattcattatatcgaaacaacaataacaaagggtaaaaaa 148  Q
    |||||||||||||||||||||||||||||||||||||             ||||||||||||||||||||||||||||||||||||||||||||||||||    
13079526 gagcagagagagttgaatgaaatgaaaaagcactcagaaaaaaataaaaagagattgattcattcattatatcgaaacaacaataacaaagggtaaaaaa 13079625  T
149 tattatgttatgtttggttttattgataattatttata 186  Q
    ||||||||||||||||||||||||||||||||||||||    
13079626 tattatgttatgtttggttttattgataattatttata 13079663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 199 - 242
Target Start/End: Original strand, 13079709 - 13079752
Alignment:
199 tatcgaatcatgtcatgtgtgaaactccctctctttctctgtgg 242  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
13079709 tatcgaatcatgtcatgtgtgaaactccctctctttctctgtgg 13079752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 99 - 186
Target Start/End: Complemental strand, 19340524 - 19340437
Alignment:
99 gagattgattcattcattatatcgaaacaacaataacaaagggtaaaaaatattatgttatgtttggttttattgataattatttata 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
19340524 gagattgattcattcattatatcgaaacaacaataacaaagggtaaaaaatattatgttacgtttggttttattgataattatttata 19340437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University