View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_123 (Length: 287)
Name: NF1305_low_123
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_123 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 41304409 - 41304151
Alignment:
| Q |
1 |
taggcaatatcggggcgagtatgtgacagataaataagcttccccaccaatttttgataccttattttatctgcgggcacttggtctgtgtattcggtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41304409 |
taggcaatatcggggcgagtatgtgacagataaataagcttccccaccaattttttataccttattttatctgcgggcacttggtctgtgtattcagtga |
41304310 |
T |
 |
| Q |
101 |
gtttgtgattttaggctatgggagtatctactggtttgcaatccaacatccccacttcagacaatagatccaacacatactttatttgagacaagaaaat |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41304309 |
gtttgtgattttgggctatgggagtatctactggtttacaatccaacatccccacttcagacaatagatccaacacatactttctttgagacaagaaaat |
41304210 |
T |
 |
| Q |
201 |
tcccctttttgaccttgcaacttctattcccaaaaaatacttcagtccacccaaattct |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41304209 |
tcccctttttgaccttgcaacttctattcccaaaaaatacttcagtccacccaaattct |
41304151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University