View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1305_low_128 (Length: 274)

Name: NF1305_low_128
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1305_low_128
NF1305_low_128
[»] chr2 (1 HSPs)
chr2 (1-152)||(22198268-22198419)
[»] chr8 (2 HSPs)
chr8 (60-152)||(6814227-6814319)
chr8 (8-48)||(6814319-6814359)
[»] chr3 (1 HSPs)
chr3 (25-133)||(6098033-6098146)


Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 22198419 - 22198268
Alignment:
1 gcggaaataacgatctcttcttgatcgtgagtttgatggacagatggattgaggtggtaagagggagaacgagtgaacggtgaggtgaaaaaacgagatc 100  Q
    |||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
22198419 gcggcaataacgatctcttcttcatcgtgagtttgatggagagatggattgaggtggtgagagggagaacgagtgaacggtgaggtgaaaaaacgagatc 22198320  T
101 aatagagaaaaatatgtgatgggtttaccatttatgagtaggttctgtggtg 152  Q
    |||||||||||||||||||||||||||| ||||||||| |||||||||||||    
22198319 aatagagaaaaatatgtgatgggtttacgatttatgagaaggttctgtggtg 22198268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 60 - 152
Target Start/End: Complemental strand, 6814319 - 6814227
Alignment:
60 agagggagaacgagtgaacggtgaggtgaaaaaacgagatcaatagagaaaaatatgtgatgggtttaccatttatgagtaggttctgtggtg 152  Q
    |||| ||||| ||| ||| ||||||||||||||||||  ||||| ||||| |||||||||||||| | | ||||||||| ||||| |||||||    
6814319 agagtgagaaagagggaaaggtgaggtgaaaaaacgatttcaattgagaagaatatgtgatgggtatgcgatttatgagaaggttttgtggtg 6814227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 6814359 - 6814319
Alignment:
8 taacgatctcttcttgatcgtgagtttgatggacagatgga 48  Q
    ||||||||||||||| || |||||||||||||| |||||||    
6814359 taacgatctcttcttcattgtgagtttgatggagagatgga 6814319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 133
Target Start/End: Complemental strand, 6098146 - 6098033
Alignment:
25 tcgtgagtttgatggacagatggattgaggtggtaag------agggagaacgagtgaacggtgaggtgaaaaaacgagatcaatagagaaaaatatgtg 118  Q
    |||||||||||||||| ||||||||| || |||| ||      || |||||||||||||  ||||||||| |||||||| ||||| ||||| ||| ||||    
6098146 tcgtgagtttgatggaaagatggattaagatggtgagtgaggaagtgagaacgagtgaaaagtgaggtga-aaaacgagttcaattgagaagaatttgtg 6098048  T
119 atgggtttaccattt 133  Q
    |||||| ||| ||||    
6098047 atgggtatacgattt 6098033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University