View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_141 (Length: 250)
Name: NF1305_low_141
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_141 |
 | |
|
| [»] scaffold0025 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0025 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 17 - 250
Target Start/End: Original strand, 23277 - 23518
Alignment:
| Q |
17 |
tcctcaaattccccatattaccctcacctctcacaatnnnnnnnnnn--tcacaaatcgtcaacaacttagaaaaccgaaaatcataatcatcatcaccc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23277 |
tcctcaaattccccatattaccctcacctctcacaataaaaaaaaacaatcacaaatcgtcaacaacttagaaaaccgaaaatcataatcatcatcaccc |
23376 |
T |
|
| Q |
115 |
aaatcaccacaaaggcaatgccttgcgattcttccatcatttctagcgataacagtaacagcaacaacaacaacgagaaagagaagagtaagaaaagcga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23377 |
aaatcaccacaaaggcaatgccttgcgattcttccgtcatttctagcgataacagtaacagcaacaacaacaacgagaaagagaagagtaagaaaagcga |
23476 |
T |
|
| Q |
215 |
tga------ttcttcttcactcggtgatttcaaattgaacga |
250 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23477 |
tgattcttcttcttcttcactcggtgatttcaaattgaacga |
23518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University