View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_144 (Length: 243)
Name: NF1305_low_144
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_144 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 101 - 170
Target Start/End: Original strand, 35882710 - 35882779
Alignment:
| Q |
101 |
cccggtgaaatacacgtggcaatcaaggttcttgaacatgtcagagacgttgattatgatgactctgtgg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35882710 |
cccggtgaaatacacgtggcaatcaaggttcttgaacatgtcagagacgttgattatgatgactctgtgg |
35882779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 101 - 170
Target Start/End: Original strand, 24456911 - 24456980
Alignment:
| Q |
101 |
cccggtgaaatacacgtggcaatcaaggttcttgaacatgtcagagacgttgattatgatgactctgtgg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24456911 |
cccggtgaaatacacgtggcaatcaaggttcttgaacatgtcagagacgttgattatgatgactctgtgg |
24456980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University