View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_148 (Length: 231)
Name: NF1305_low_148
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_148 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 6 - 231
Target Start/End: Original strand, 36629305 - 36629533
Alignment:
| Q |
6 |
accaagaagatgcgatggtcgaatctgagatgaatgatagagattgcgagctgattgtaagcgtttcaatgacatcttcttcgtcttcaacttcgatgta |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36629305 |
accaagaagatgcgatggtcgaatctgagatgaatgatagagattgcgagctgattgtaagcgtttcaatgacatcttcttcgtcttcaacttcgatgta |
36629404 |
T |
 |
| Q |
106 |
gaagca------ttacagttacagttattgatcaattgatgaaagatgattattgattgattcagttcaatcaaagaacaattgcaggtttctggttttc |
199 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36629405 |
gaagcattacagttacagttacagttattgatcaattgatgaaa---gattattgattgattcagttcaatcaaagaacaattgcaggtttctggttttc |
36629501 |
T |
 |
| Q |
200 |
aagggtgtaagcattcaacgtcgggctgtaaa |
231 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |
|
|
| T |
36629502 |
aagggtttaagcattcaacgtcgggctgtaaa |
36629533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University