View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1305_low_148 (Length: 231)

Name: NF1305_low_148
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1305_low_148
NF1305_low_148
[»] chr1 (1 HSPs)
chr1 (6-231)||(36629305-36629533)


Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 6 - 231
Target Start/End: Original strand, 36629305 - 36629533
Alignment:
6 accaagaagatgcgatggtcgaatctgagatgaatgatagagattgcgagctgattgtaagcgtttcaatgacatcttcttcgtcttcaacttcgatgta 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36629305 accaagaagatgcgatggtcgaatctgagatgaatgatagagattgcgagctgattgtaagcgtttcaatgacatcttcttcgtcttcaacttcgatgta 36629404  T
106 gaagca------ttacagttacagttattgatcaattgatgaaagatgattattgattgattcagttcaatcaaagaacaattgcaggtttctggttttc 199  Q
    ||||||      ||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||    
36629405 gaagcattacagttacagttacagttattgatcaattgatgaaa---gattattgattgattcagttcaatcaaagaacaattgcaggtttctggttttc 36629501  T
200 aagggtgtaagcattcaacgtcgggctgtaaa 231  Q
    |||||| |||||||||||||||||||||||||    
36629502 aagggtttaagcattcaacgtcgggctgtaaa 36629533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University