View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_158 (Length: 212)
Name: NF1305_low_158
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_158 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 14513496 - 14513587
Alignment:
| Q |
1 |
tgatattaagattcttgttcttaaacttgaaattaatgaatgaaaaggtttatgtgtctttttcattggttttgttcttcaccttggatatt |
92 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14513496 |
tgatattaagattcttgttcctaaacttgaaattaatcaatgagaaggtttatgtgtctttttcattggttttgttcttcaccttggatatt |
14513587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University