View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_159 (Length: 209)
Name: NF1305_low_159
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_159 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 17 - 96
Target Start/End: Complemental strand, 41697298 - 41697219
Alignment:
| Q |
17 |
tgacttggtcgttaaggatttgatgttattcagatagaatttagttgcataacttttcaaaataaaggggtttaatcgga |
96 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41697298 |
tgacttggttgttaaggatttgatgttattcggatagaatttagttgcataacttttcaaaataaaggggtttaatcgga |
41697219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University