View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1305_low_160 (Length: 208)

Name: NF1305_low_160
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1305_low_160
NF1305_low_160
[»] chr7 (1 HSPs)
chr7 (17-96)||(41697219-41697298)


Alignment Details
Target: chr7 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 17 - 96
Target Start/End: Complemental strand, 41697298 - 41697219
Alignment:
17 tgacttggtcgttaaggatttgatgttattcagatagaatttagttgcataacttttcaaaataaaggggtttaatcgga 96  Q
    ||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
41697298 tgacttggttgttaaggatttgatgttattcggatagaatttagttgcataacttttcaaaataaaggggtttaatcgga 41697219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University