View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_161 (Length: 203)
Name: NF1305_low_161
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_161 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 2 - 124
Target Start/End: Complemental strand, 30431880 - 30431758
Alignment:
| Q |
2 |
tttatttcatattcagatacaacatttattgctttgttatatatgaccaaatttacattttcatccccagtgttaatatatctggtatgttttggatggt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||| | |
|
|
| T |
30431880 |
tttatttcatattcagatacaacatttattgttttgttatatatgaccaaatttacattttcatcctcagtattaatgtatctggtatgttttggatgat |
30431781 |
T |
|
| Q |
102 |
accatttggagtctgtggtgctg |
124 |
Q |
| |
|
||||||||| ||| ||| ||||| |
|
|
| T |
30431780 |
accatttggggtcagtgttgctg |
30431758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 14 - 111
Target Start/End: Complemental strand, 30415229 - 30415132
Alignment:
| Q |
14 |
tcagatacaacatttattgctttgttatatatgaccaaatttacattttcatccccagtgttaatatatctggtatgttttggatggtaccatttgga |
111 |
Q |
| |
|
||||||||||| |||||||||| |||| | || | |||||||| |||||||| ||||||||||||||| |||||| ||||||||||||| |||||| |
|
|
| T |
30415229 |
tcagatacaaccattattgctttattatctgtggctaaatttactttttcatctacagtgttaatatatccggtatgctttggatggtaccgtttgga |
30415132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University