View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1305_low_162 (Length: 203)

Name: NF1305_low_162
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1305_low_162
NF1305_low_162
[»] chr6 (2 HSPs)
chr6 (2-123)||(30431759-30431880)
chr6 (14-111)||(30415132-30415229)


Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 2 - 123
Target Start/End: Complemental strand, 30431880 - 30431759
Alignment:
Q  2 tttatttcatattcagatacaacatttattgctttgttatatatgaccaaatttacattttcatccccagtgttaatatatctggtatgttttggatggt 101  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||| |    
T  30431880 tttatttcatattcagatacaacatttattgttttgttatatatgaccaaatttacattttcatcctcagtattaatgtatctggtatgttttggatgat 30431781  T
Q  102 accatttggagtctgtggtgct 123  Q
    ||||||||| ||| ||| ||||    
T  30431780 accatttggggtcagtgttgct 30431759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 14 - 111
Target Start/End: Complemental strand, 30415229 - 30415132
Alignment:
Q  14 tcagatacaacatttattgctttgttatatatgaccaaatttacattttcatccccagtgttaatatatctggtatgttttggatggtaccatttgga 111  Q
    |||||||||||  |||||||||| |||| | || | |||||||| ||||||||  ||||||||||||||| |||||| ||||||||||||| ||||||    
T  30415229 tcagatacaaccattattgctttattatctgtggctaaatttactttttcatctacagtgttaatatatccggtatgctttggatggtaccgtttgga 30415132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University