View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_163 (Length: 201)
Name: NF1305_low_163
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_163 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 5217405 - 5217509
Alignment:
| Q |
1 |
ttcttatgaaaaagagtaacatttatttaattataatgagaattgtattgaatgttgccgacaatatatacaggttgatagtgcaaacaagtatgggata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5217405 |
ttcttatgaaaaagagtaacatttatttaattataatgagaatggtcttgaatgttgccgacaatatatacaggttgatagtgcaaacaagtatgggata |
5217504 |
T |
 |
| Q |
101 |
ttatt |
105 |
Q |
| |
|
||||| |
|
|
| T |
5217505 |
ttatt |
5217509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University