View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_46 (Length: 437)
Name: NF1305_low_46
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_46 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 81 - 343
Target Start/End: Complemental strand, 27859499 - 27859235
Alignment:
| Q |
81 |
attaagatgagttaccctgatgtagcttttgcaaaatcagggtgagccatactgattctgacaaacctacggtgataacaaccatgcactgatttgattg |
180 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27859499 |
attaagatgagtcaccctgatgtagcttttgcaaaatcagggtgagccatactgattctgacaaacctacggtgataacaagcatgcactgatttgattg |
27859400 |
T |
|
| Q |
181 |
ttttgatgtcagtgttgcagttgcagacat-nnnnnnncaaactaaaattataagttattttatggtgttgcagtttgtttggatctttagatttagaga |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27859399 |
ttttgatgtcagtgttgcagttgcagacataacaaaaacaaactaaaattataagttattttatggtgttgcag-ttgtttggatctttagatttagaga |
27859301 |
T |
|
| Q |
280 |
gatgaagtttctctctctaaatctaacgatggc--caactacagcaccatattgaaactatagagg |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
27859300 |
gatgaagtttctctctctaaatctaacgatggctacaactgcagcaccatattgaaactatagagg |
27859235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 357 - 427
Target Start/End: Complemental strand, 42143879 - 42143812
Alignment:
| Q |
357 |
aatcaaggcctgaagttggttaatcaagtagtagcagcagttaaggatcaacaagtatttcatagcctatg |
427 |
Q |
| |
|
||||||| ||||||||||| | ||||||||||||||| | |||| |||||||| ||||||||||||||| |
|
|
| T |
42143879 |
aatcaagacctgaagttggctcatcaagtagtagcag---tgaaggctcaacaagaatttcatagcctatg |
42143812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University