View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_64 (Length: 372)
Name: NF1305_low_64
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 72 - 268
Target Start/End: Complemental strand, 23029433 - 23029232
Alignment:
| Q |
72 |
attaaattgatcgttttcatgt------aaattttcaacgaaatgaatgaacaattcttgagaaaaacaaagaattgagaagccaaaatgacaaaaacta |
165 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||| |||||||||| |
|
|
| T |
23029433 |
attaatttgatcgttttcatgtcacccgaaattttcaacgaaatgaatgaacaattcttgagaaaa-caaagtattgaaaagccaaaatcacaaaaacta |
23029335 |
T |
 |
| Q |
166 |
acactaaaatcacatgaaatgaatgattacggaacgaaaattactaattcaaaagaaacggttgcataaataaaactaggagatataacattagaattta |
265 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| || ||||||||||||||||| |
|
|
| T |
23029334 |
accctaaaatcacatgaaatgaatgattacggaacgaaaattactagatcaaaagaaacggttgtataaataaaactactagctataacattagaattta |
23029235 |
T |
 |
| Q |
266 |
ccc |
268 |
Q |
| |
|
||| |
|
|
| T |
23029234 |
ccc |
23029232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 13 - 43
Target Start/End: Complemental strand, 23029465 - 23029435
Alignment:
| Q |
13 |
aatattaaggtttgcattatagccacaacta |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23029465 |
aatattaaggtttgcattatagccacaacta |
23029435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University