View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_75 (Length: 352)
Name: NF1305_low_75
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_75 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 82 - 352
Target Start/End: Complemental strand, 48536115 - 48535844
Alignment:
| Q |
82 |
gagcaggttgttttctctgacccatacaaagtttctgagtataatcgttggacttcacctaatcttgaccgtgatgctgaggctgttcgggaagacaatc |
181 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48536115 |
gagcaggttgttttctctgacccatataaagtttctgagtataatcgttggacttcacctaatcttgaccgtgatgctgaggctgttcgggaagacaatc |
48536016 |
T |
 |
| Q |
182 |
tactgaagcttgaagttgctgagctaaaatcaaagtattatatatgtctcacactctcac-tttcttcttcttttaatgcagtagttttgttgtttgggt |
280 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48536015 |
tactaaagcttgaagttgctgagctaaaatcaaagtattatatatgtctcacactctcactttttttcttcttttaatgcagtagttttgttgtttgggt |
48535916 |
T |
 |
| Q |
281 |
ttttgttgatgaaaatttatgttcattcaggttctgtgagagggctcaggcactaatacatggagatctaca |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48535915 |
ttttgttgatgaaaatttatgttcattcaggttctgtgagagggctcaggcactaatacatggagatctaca |
48535844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University