View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_77 (Length: 347)
Name: NF1305_low_77
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_77 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 8e-89; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 85 - 285
Target Start/End: Original strand, 29917430 - 29917630
Alignment:
| Q |
85 |
ggtacgtataaacaactttctcaccgcatttgcagaagaattgatttgcgttgatagttgcatgtgttggggnnnnnnnnnccaacttcttcaacttcac |
184 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29917430 |
ggtatgtataaacaactttctcaccgcatttgcagaagaattgatttgcgttgatagttgcatgtgttggggtttttttttccaacttcttcaacttcac |
29917529 |
T |
|
| Q |
185 |
catactctgatggacgcccctccaattaagaagcaacgacgacgccgacccagtcgatccaatgcaacatatccgactttgttcctcccagacgaactca |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29917530 |
tatactctgatggacgcccctccaattaagaagcaacgacgacgccgacccagtcgatccaatgcaacatatccgactttgttcctcccagacgaactca |
29917629 |
T |
|
| Q |
285 |
t |
285 |
Q |
| |
|
| |
|
|
| T |
29917630 |
t |
29917630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 254 - 318
Target Start/End: Original strand, 23992661 - 23992725
Alignment:
| Q |
254 |
tatccgactttgttcctcccagacgaactcatcgtagaaatcctatctttgcttagggttaaaaa |
318 |
Q |
| |
|
||||| || ||||||||||| || ||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
23992661 |
tatccaaccttgttcctcccggatgaactcatcatagaaatcctatcttttcttagggttaaaaa |
23992725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 259 - 301
Target Start/End: Original strand, 24001312 - 24001354
Alignment:
| Q |
259 |
gactttgttcctcccagacgaactcatcgtagaaatcctatct |
301 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
24001312 |
gactttgttcctcccagacgaactcatagcagaaatcctatct |
24001354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 259 - 318
Target Start/End: Original strand, 24009496 - 24009555
Alignment:
| Q |
259 |
gactttgttcctcccagacgaactcatcgtagaaatcctatctttgcttagggttaaaaa |
318 |
Q |
| |
|
|||||||||||||||||| |||||||| | ||||||||||||| ||||| |||||||| |
|
|
| T |
24009496 |
gactttgttcctcccagatgaactcatagcagaaatcctatctcaccttagcgttaaaaa |
24009555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University