View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_83 (Length: 330)
Name: NF1305_low_83
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_83 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 57 - 274
Target Start/End: Original strand, 17770832 - 17771058
Alignment:
| Q |
57 |
agagattggttatgatagagggtgaagaggtttaagagagaagcaagtgaggaaaagtgatttatataaaagaaagaaaggatgtggtaaaacaggaagt |
156 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
17770832 |
agagattggttgtgatagagggtgaagagatttaagagagaagcaagtgaggaaaagtgatttatataaaagaaagaaaggatgtggtaaaatagaaagt |
17770931 |
T |
 |
| Q |
157 |
tgaaacaattaatgataaatggtgtccttttgagcttgtaaccttttgatttcggctgacagtgctgt---------tttttctgctgcatttcaactct |
247 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17770932 |
tgaaacaaataatgataaatggtgtctttttgagcttgtaaccttttgatttcggctgacagtgctgttttttctggtttttctgctgcatttcaactct |
17771031 |
T |
 |
| Q |
248 |
tctgcttcgtttttctgttggtctgtg |
274 |
Q |
| |
|
||| ||||||||||||||||||||||| |
|
|
| T |
17771032 |
tctacttcgtttttctgttggtctgtg |
17771058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 102 - 171
Target Start/End: Original strand, 41066752 - 41066821
Alignment:
| Q |
102 |
agtgaggaaaagtgatttatataaaagaaagaaaggatgtggtaaaacaggaagttgaaacaattaatga |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||||||| |
|
|
| T |
41066752 |
agtgaggaaaagtgatttatataaaagaaagaaaggatgttgtaaaacagaaagttgggacaattaatga |
41066821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 57 - 136
Target Start/End: Complemental strand, 5391797 - 5391726
Alignment:
| Q |
57 |
agagattggttatgatagagggtgaagaggtttaagagagaagcaagtgaggaaaagtgatttatataaaagaaagaaag |
136 |
Q |
| |
|
||||||||||| |||||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5391797 |
agagattggttgtgatagagggtgaattgatttaagagagaag--------gaaaagtgatttatataaaagaaagaaag |
5391726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University