View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_85 (Length: 328)
Name: NF1305_low_85
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_85 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 5e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 98 - 295
Target Start/End: Original strand, 25771935 - 25772130
Alignment:
| Q |
98 |
ttcacatggtatcattcaaatgatcgtgaaatcagttggattgatagaattcttgtttcgcggaagaatgaactaattattaggggaattaagtgttgtg |
197 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25771935 |
ttcacatggtatcattcaaatgatcatgaaatgagttggattgatagaattcttgtttcg--gaagaatgaattaattattaggggaattaagtgttgtg |
25772032 |
T |
 |
| Q |
198 |
ggtgcctccgcgagatatatcggatcattgcactttggtgttaaaggtgaataattgttaaagagggagacatggggaatcccaccactgtgaggcaa |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25772033 |
ggtgcctccgcgagatatatcggatcattgttctttggtgttaaaggtgaataattgttaaagagggagacatggggaatcccaccactttgaggcaa |
25772130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University