View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_91 (Length: 320)
Name: NF1305_low_91
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_91 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 126 - 291
Target Start/End: Complemental strand, 23574089 - 23573922
Alignment:
| Q |
126 |
cttttagtgtgccatgttgtatataataattcatccatgtg-tacaccattagttttgannnnnnnnaacaaaaacttaa-cagaaagaatatttgcaag |
223 |
Q |
| |
|
||||||||||||||||||| || |||||||| |||||| || ||||||||||||||||| ||||||||||||| ||||| ||||||||||||| |
|
|
| T |
23574089 |
cttttagtgtgccatgttgcatgtaataattgatccatatgatacaccattagttttgattttttt-aacaaaaacttaaacagaaggaatatttgcaag |
23573991 |
T |
 |
| Q |
224 |
atcattacaaagtgcagaactaatgacatatttaagctttta-ttacaacacttgacaatttcgattcc |
291 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
23573990 |
atcattacaaagtgcaggactaatgacatatttaagcttttatttacaacacctgacaatttcgattcc |
23573922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 41033962 - 41033992
Alignment:
| Q |
1 |
aggaaatgacttatgcaccataaccactccc |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41033962 |
aggaaatgacttatgcaccataaccactccc |
41033992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University