View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1305_low_96 (Length: 315)
Name: NF1305_low_96
Description: NF1305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1305_low_96 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 31793009 - 31792726
Alignment:
| Q |
1 |
taagcataatgtgcaaacatgcagctctcaagttaaaatggtagaagcatgtgatgtgtatatttgttcccgaccatcttccaccttcacgcattgaaga |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31793009 |
taagtataatgtgcaaacatgcagctctcaagttaaaatggtagaagcatgtgatgtgtatatttgttcccgaccatcttccaccttcacgcattgaaga |
31792910 |
T |
|
| Q |
101 |
agaatgcaagctccacctagaactattctttttgtctctacttttccaataaaccaaaatgnnnnnnnnntaataaaagctacttactccaccccctaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31792909 |
agaatgcaagctccacctagaactattctttttgtctctacttttccaataaaccaaaatg-aaaaaaaataataaaagctacttactccaccccctaat |
31792811 |
T |
|
| Q |
201 |
ttaaaattagttcaaaattacatatccnnnnnnnnnnttatcaaaatttttcatgcatatttctggacaacttgtgcagtcaaaac |
286 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31792810 |
ttaaaattagttcaaaattacatatcc-aaaaaaaaattatcaaaatttttcatgcatatttctggacaacttgtgcagtcaaaac |
31792726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 7 - 81
Target Start/End: Complemental strand, 31806348 - 31806273
Alignment:
| Q |
7 |
taatgtgcaa-acatgcagctctcaagttaaaatggtagaagcatgtgatgtgtatatttgttcccgaccatcttc |
81 |
Q |
| |
|
|||||||||| ||||||||||| |||| || |||| |||||||| |||||||||||||||||||| | ||||||| |
|
|
| T |
31806348 |
taatgtgcaagacatgcagctcataagtcaagatggaagaagcatctgatgtgtatatttgttcccaagcatcttc |
31806273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University