View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13060_high_8 (Length: 263)

Name: NF13060_high_8
Description: NF13060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13060_high_8
NF13060_high_8
[»] chr5 (1 HSPs)
chr5 (90-254)||(3472684-3472848)


Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 90 - 254
Target Start/End: Complemental strand, 3472848 - 3472684
Alignment:
90 gacggttattgagtttagagcgttgattatttgggcctaagcccattaaaaaagagggattggtgtgtgtggggacgggtgcgtgaagtaggttgtgggt 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
3472848 gacggttattgagtttagagcgttgattatttgggcctaagcccattaaaaaagagggatcggtgtgtgtggggacgggtgcgtgaagtaggttgtgggt 3472749  T
190 taattatttatgtgagaaagtgaaatggtagactactgggaactcaagttatatttaatctctgc 254  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3472748 taattatttatgtgagaaagtgaaatggtagactactgggaactcaagttatatttaatctctgc 3472684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University