View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13060_low_10 (Length: 246)

Name: NF13060_low_10
Description: NF13060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13060_low_10
NF13060_low_10
[»] chr5 (1 HSPs)
chr5 (18-158)||(3473079-3473219)
[»] chr8 (1 HSPs)
chr8 (106-150)||(2582424-2582468)


Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 18 - 158
Target Start/End: Complemental strand, 3473219 - 3473079
Alignment:
18 gggcttgggtcgggttaccgccgagagaacgcatgaggattccaagctccgatggtgcgatattgccgtcgttgtcggtgtcgaagagtgtgaatgcttc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
3473219 gggcttgggtcgggttaccgccgagagaacgcatgaggattccaagctccgatggtgcgatattgccgtcgttgtcggtgtcgaatagtgtgaatgcttc 3473120  T
118 tttcattgatgagatttgatcgtcgcttagatccttaccca 158  Q
    |||||||||||||||||||||||||||||||||||||||||    
3473119 tttcattgatgagatttgatcgtcgcttagatccttaccca 3473079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 106 - 150
Target Start/End: Original strand, 2582424 - 2582468
Alignment:
106 tgtgaatgcttctttcattgatgagatttgatcgtcgcttagatc 150  Q
    |||| ||||||||||||||||||||||||||| || ||| |||||    
2582424 tgtggatgcttctttcattgatgagatttgattgtggctcagatc 2582468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University