View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13060_low_10 (Length: 246)
Name: NF13060_low_10
Description: NF13060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13060_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 18 - 158
Target Start/End: Complemental strand, 3473219 - 3473079
Alignment:
| Q |
18 |
gggcttgggtcgggttaccgccgagagaacgcatgaggattccaagctccgatggtgcgatattgccgtcgttgtcggtgtcgaagagtgtgaatgcttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3473219 |
gggcttgggtcgggttaccgccgagagaacgcatgaggattccaagctccgatggtgcgatattgccgtcgttgtcggtgtcgaatagtgtgaatgcttc |
3473120 |
T |
|
| Q |
118 |
tttcattgatgagatttgatcgtcgcttagatccttaccca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3473119 |
tttcattgatgagatttgatcgtcgcttagatccttaccca |
3473079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 106 - 150
Target Start/End: Original strand, 2582424 - 2582468
Alignment:
| Q |
106 |
tgtgaatgcttctttcattgatgagatttgatcgtcgcttagatc |
150 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
2582424 |
tgtggatgcttctttcattgatgagatttgattgtggctcagatc |
2582468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University