View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13060_low_8 (Length: 263)
Name: NF13060_low_8
Description: NF13060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13060_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 90 - 254
Target Start/End: Complemental strand, 3472848 - 3472684
Alignment:
| Q |
90 |
gacggttattgagtttagagcgttgattatttgggcctaagcccattaaaaaagagggattggtgtgtgtggggacgggtgcgtgaagtaggttgtgggt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3472848 |
gacggttattgagtttagagcgttgattatttgggcctaagcccattaaaaaagagggatcggtgtgtgtggggacgggtgcgtgaagtaggttgtgggt |
3472749 |
T |
 |
| Q |
190 |
taattatttatgtgagaaagtgaaatggtagactactgggaactcaagttatatttaatctctgc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3472748 |
taattatttatgtgagaaagtgaaatggtagactactgggaactcaagttatatttaatctctgc |
3472684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University