View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13061_high_36 (Length: 406)
Name: NF13061_high_36
Description: NF13061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13061_high_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 162 - 394
Target Start/End: Original strand, 36285666 - 36285898
Alignment:
| Q |
162 |
cgaaatagtctatttcaatgaagatgttagctgttnnnnnnnntatagtgtttgtgtttcaatacttgtaatnnnnnnngtcataatcatcccttttgaa |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36285666 |
cgaaatagtctatttcaatgaagatgttagctgttaaaaaaattatagtgtttgtgtttcaatacttgtaataaaaaaagtcataatcatcccttttgaa |
36285765 |
T |
 |
| Q |
262 |
gtgtataacttcttgtggcttccataaaaagaactatggagcgctgctgtttttgaagggtcagggataatcataaaaacaatgggtttattgcaataaa |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36285766 |
gtgtataacttcttgtggcttccataaaaagaactatggagcgctgctgtttttgaagggtcagggataatcataaaaacaatgggtttattgcaataaa |
36285865 |
T |
 |
| Q |
362 |
gatgattaattgctttggctttctagggctgat |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36285866 |
gatgattaattgctttggctttctagggctgat |
36285898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 36285442 - 36285585
Alignment:
| Q |
21 |
ctcgggtgctcgcatgcttagactgtctccatgtttctgctgcgtttttcttttgggctatgtgatctgtatagttctggtagggtactatgtaattttc |
120 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36285442 |
ctcgggtgctcgcatgcttagactgcctccacttttctgctgcgtttttcttttgggttatgtgatctgtatagttctggtagggtactttgtaattttc |
36285541 |
T |
 |
| Q |
121 |
tcttgtttatggctgggtgttgtgttgtgttttcaacgggccga |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36285542 |
tcttgtttatggctgggtgttgtgttgtgttttcaacgggccga |
36285585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University