View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13061_high_56 (Length: 297)
Name: NF13061_high_56
Description: NF13061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13061_high_56 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 5 - 274
Target Start/End: Complemental strand, 3728886 - 3728621
Alignment:
| Q |
5 |
gagttggcggcggagaaagactcggcattcaggcgagccgcccggtggaagttagatatggcaacaacatataacagggtggaatgggactttccctaag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3728886 |
gagttggcggcggagaaagactcggcattcaggcgagccgcccggtggaagttagatatggcaacaacatataacagggtggaatgggactttccctaag |
3728787 |
T |
 |
| Q |
105 |
agtctggttaacaccattatgcactgcgtgagaagtttttctttttgtttcgacatcttataattatgaagtaaattgttttgaattattcatatcttca |
204 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3728786 |
agtctggttaacaccattatgcagtgcgtgagaagtttttctttttgtttcgacatcttataattatgaagtaaattgttttgaattattcatatcttca |
3728687 |
T |
 |
| Q |
205 |
caatttgctgttcaatttgaagacatagactgtgggagtgatgctctcaagataatgttatctccacttt |
274 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3728686 |
caatttgctgttaaatttgaagacatagactgt----gtgatgctctcaagataatgttatctccacttt |
3728621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 18561907 - 18561860
Alignment:
| Q |
1 |
cgtcgagttggcggcggagaaagactcggcattcaggcgagccgcccg |
48 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
18561907 |
cgtcgagttggcggcgcagaaagactcgacattcaggcgagccgcccg |
18561860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University