View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13061_high_71 (Length: 250)
Name: NF13061_high_71
Description: NF13061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13061_high_71 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 18 - 250
Target Start/End: Complemental strand, 3639550 - 3639318
Alignment:
| Q |
18 |
agtgaagtccatgaaactacgtcgggtgaaggaattgatttgaaaacgcgcgttgctgaaacgacgtcgtttgaggagaggtaaaaatagagtaaagtgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3639550 |
agtgaagtccatgaaactacgtcgggtgaaggaattgatttgaaaacgcgcgttgctgaaacgacgtcgtttgaggagaggtaaaaatagagtaaagtgt |
3639451 |
T |
 |
| Q |
118 |
ttttgatgaagccatcgaagatgtgaccggatttgatgagacgcgcgtggatttcaagacctttggcgtgcgcatgataggaacaacatgctttgagcgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3639450 |
ttttgatgaagccatcgaagatgtgaccggatttgatgagacgcgcgtggatttcaagacctttggcgtgcgcatgataggaacaacatgctttgagcgc |
3639351 |
T |
 |
| Q |
218 |
gtgggtgaaggtgtagtgattgtgggaagaaga |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3639350 |
gtgggtgaaggtgtagtgattgtgggaagaaga |
3639318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University