View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13061_high_75 (Length: 246)

Name: NF13061_high_75
Description: NF13061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13061_high_75
NF13061_high_75
[»] chr1 (1 HSPs)
chr1 (1-228)||(34942711-34942938)


Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 34942938 - 34942711
Alignment:
1 acaacgattgaggaaatgggaataacaacaagtcttgtaggatatagatgagattaaaaatatattctgataatcttctttttacataactatctatgaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
34942938 acaacgattgaggaaatgggaataacaacaagtcttgtaggatatagatgagattaaaaatatattctgataatcttctttttacataactatctaagaa 34942839  T
101 agttattagacaaatgtgtccaattgtctcaacaaaattatattctcatgcagcagatattgcattttgcagtttttgtctttcaacgccacccaccaac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34942838 agttattagacaaatgtgtccaattgtctcaacaaaattatattctcatgcagcagatattgcattttgcagtttttgtctttcaacgccacccaccaac 34942739  T
201 tgttttttcctatatttaacaggaacta 228  Q
    |||||||||| |||||||||||||||||    
34942738 tgttttttcccatatttaacaggaacta 34942711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University