View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13061_high_80 (Length: 231)

Name: NF13061_high_80
Description: NF13061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13061_high_80
NF13061_high_80
[»] chr8 (1 HSPs)
chr8 (3-64)||(28737385-28737446)


Alignment Details
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 3 - 64
Target Start/End: Complemental strand, 28737446 - 28737385
Alignment:
3 tgggaagcgcttttgcatttggctttttggttacgatttacataacaaaataatcaattgtc 64  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
28737446 tgggaagcacttttgcatttggctttttggttacgatttacataacaaaataatcaattgtc 28737385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University