View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13061_high_81 (Length: 229)
Name: NF13061_high_81
Description: NF13061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13061_high_81 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 8e-51; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 11 - 116
Target Start/End: Original strand, 11359774 - 11359879
Alignment:
| Q |
11 |
tcgaagaatattgtgaagtcattttgaagttaacaacttcttatctgtcacctcaatatcttatgatgctttgtcttattggactcaattgcaatgacct |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11359774 |
tcgaataatattgtgaagtcattttgaagttaacaacttcttatctgtcacctcaatatcttatgatgctttgtcttattggactcaattgcaatgacct |
11359873 |
T |
 |
| Q |
111 |
gtaatc |
116 |
Q |
| |
|
|||||| |
|
|
| T |
11359874 |
gtaatc |
11359879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 17 - 113
Target Start/End: Original strand, 11337503 - 11337602
Alignment:
| Q |
17 |
aatattgtgaagtcattttgaagttaacaacttcttatctgtcacctcaatatcttatgatgctttgtcttattggactcaa---ttgcaatgacctgta |
113 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||| ||||||||||||| ||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
11337503 |
aatattgtaaagtcattttgaagttaacagcttcttatctgtcatctcaatatcttattatgatttggcttattggactcaatatttgcaatgacctgta |
11337602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 153 - 214
Target Start/End: Original strand, 11359917 - 11359978
Alignment:
| Q |
153 |
taatattaaaatgaacacgctctcaaaaagtaagcttgattttgaggacaatagaaacacat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11359917 |
taatattaaaatgaacacgctctcaaaaagtaagcttgattctgaggacaatagaaacacat |
11359978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University