View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13061_high_85 (Length: 207)
Name: NF13061_high_85
Description: NF13061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13061_high_85 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 5e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 16 - 207
Target Start/End: Original strand, 31186094 - 31186285
Alignment:
| Q |
16 |
attactaggcccccttactctagaaactagaggattaagaagagagaaaatcatataataaagtatttttatgtatgatattgtttatagtttatcttac |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31186094 |
attactaggccccctttctctagaaactagaggattaagaagagagaaaatcatataataaagtatttttatgtatgatattgtttatagtttatcttac |
31186193 |
T |
 |
| Q |
116 |
cacattgaccttggtccttgattggagtgacagctccttttaacctccaatctacagctgctggaatagcagtgacattttcatacttaaat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31186194 |
cacattgaccttggtccttgattggagtgacagctccttttactctccaatctacagctgctggaatagcagtaacattttcatacttaaat |
31186285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 77 - 207
Target Start/End: Original strand, 31194802 - 31194932
Alignment:
| Q |
77 |
agtatttttatgtatgatattgtttatagtttatcttaccacattgaccttggtccttgattggagtgacagctccttttaacctccaatctacagctgc |
176 |
Q |
| |
|
||||||| | |||||||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| | |
|
|
| T |
31194802 |
agtatttgtgtgtatgatattgttcattgtttatcttaccacattgaccttgatccttgattggagtgacagctccttttactctccaatctacagcttc |
31194901 |
T |
 |
| Q |
177 |
tggaatagcagtgacattttcatacttaaat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31194902 |
cggaatagcagtgacattttcatacttaaat |
31194932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University