View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13061_low_58 (Length: 325)
Name: NF13061_low_58
Description: NF13061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13061_low_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 4 - 306
Target Start/End: Original strand, 14347097 - 14347399
Alignment:
| Q |
4 |
atgtcgaagaatatgatggaagagcttttagagccaacaaagaaagagggcacaagccatgtgactcttaatgctgtcccttctgtgtttaaggataata |
103 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14347097 |
atgtcgaagaaaaggatggaagagcttttagagccaacaaagaaagagggcacaagccatgtgactcttaatgctgtcccttctgtgtttaaggataata |
14347196 |
T |
 |
| Q |
104 |
tagctgaggctgttccactttcaactacatttgttgtctctacttctaaagctcctaccaacacttacacttcatgggcggagcatcttagggagtttga |
203 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14347197 |
tagctgaggctgttccacttgcaactacatttgttgtctctacttctaaagctcctaccaacacttgcacttcatgggcggagcatcttagggagtttga |
14347296 |
T |
 |
| Q |
204 |
caaaggtgaggactcattatggaatttgtccatcgatcgatctaacatcgtagatgagcatataatgcgtccaactgacgaagcaaaatttgctagagct |
303 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14347297 |
caaaggtgaggactcattgtggaatttgtccatcgatcgatctaacatcatagatgagcatataatgcgtccaactgacgaagcaaaatttgctagagct |
14347396 |
T |
 |
| Q |
304 |
ggg |
306 |
Q |
| |
|
||| |
|
|
| T |
14347397 |
ggg |
14347399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University