View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13061_low_59 (Length: 303)
Name: NF13061_low_59
Description: NF13061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13061_low_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 17 - 281
Target Start/End: Original strand, 45666518 - 45666768
Alignment:
| Q |
17 |
atgaacacgattgcctagctattacgtaagaaattttgtgttctttcaattggatattgatgcatatttttcatatgacggtttaatatcctaccaaatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45666518 |
atgaacacgattgcctagctattacgtaagaaattttgtgttctttcaattggatattgatgcatatttttcatatgacggtttaatatcctaccaaatg |
45666617 |
T |
 |
| Q |
117 |
ctccacgcagaatgcannnnnnnnnnnnnnnnnnnnnngattcatgaagtgaactatattacatagcctttgccctttagcatcctcaatgcatctaatg |
216 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45666618 |
ctccacgcagaatgca----atattatatatattatatgattcatgaagtgaacta---tacatagcctt-------tagcatcctcaatgcatctaatg |
45666703 |
T |
 |
| Q |
217 |
ggagatggattggtccacaattgtaagtttgcaaccaagaatactgttgatatgacgcatttagc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45666704 |
ggagatggattggtccacaattgtaagtttgcaaccaagagtactgttgatatgacgcatttagc |
45666768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University