View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13061_low_66 (Length: 278)
Name: NF13061_low_66
Description: NF13061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13061_low_66 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 10 - 255
Target Start/End: Complemental strand, 38931631 - 38931386
Alignment:
| Q |
10 |
gtgaaggagaagaagaggaagtggtagaagagagagaaacaaaaactaaagagcattgtcaccatggtgaaaaagaaagaagccatggtgagagaacaag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931631 |
gtgaaggagaagaagaggaagtggtagaagagagagaaacaaaaactaaagagcattgtcaccatggtgaaaaagaaagaagccatggtgagagaacaag |
38931532 |
T |
 |
| Q |
110 |
aaccagagaacatgaagaacaacacaacttcttcgatgaaaccgtttgcacattgaagcttcatgagaacatagctgatccttcacgtgccgatgtgttt |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931531 |
aaccagagaacatgaaggacaacacaacttcttcgatgaaactgtttgcacattgaagcttcatgagaacatagctgatccttcacgtgccgatgtgttt |
38931432 |
T |
 |
| Q |
210 |
aacccaagagcaggtcgtataacgaatgtcaatagtttgactctcc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931431 |
aacccaagagcaggtcgtataacgaatgtcaatagtttgactctcc |
38931386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University