View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13061_low_69 (Length: 267)
Name: NF13061_low_69
Description: NF13061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13061_low_69 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 14 - 243
Target Start/End: Complemental strand, 45379647 - 45379402
Alignment:
| Q |
14 |
tactgctcaaagccaaattggaagaaaagtccttttctcacttccatttttgcgaaaataccaaaatacttttacggtagttgg---------------- |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45379647 |
tactgctcaaagccaaattggaagaaaagtccttttctcacttccatttttgcgaaaataccaaaatacttttacggtagttagttgtctttccgcaagc |
45379548 |
T |
|
| Q |
98 |
gagcgacagttaactatcatcgaagctatcttggtatttttgtggtggatgtagagcaaaaatgaaagtgaaaagagttgctttcaattggaaaaagaga |
197 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45379547 |
gagcgacagttaactatcatcaaaggtatcttggtatttttgtggtggatgtagagcaaaaatgaaagtgaaaagagttgctttcaattggaaaaagaga |
45379448 |
T |
|
| Q |
198 |
cggcccaatcctttgaagactataatttgagaactcaatcaccagt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45379447 |
cggcccaatcctttgaagactataatttgagaactcaatcaccagt |
45379402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 128 - 182
Target Start/End: Complemental strand, 37855788 - 37855734
Alignment:
| Q |
128 |
ttggtatttttgtggtggatgtagagcaaaaatgaaagtgaaaagagttgctttc |
182 |
Q |
| |
|
|||||||||||| |||| || ||||||||||||||| ||||||||||||||||| |
|
|
| T |
37855788 |
ttggtatttttgcggtgtgtgaagagcaaaaatgaaactgaaaagagttgctttc |
37855734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 132 - 183
Target Start/End: Original strand, 2758868 - 2758919
Alignment:
| Q |
132 |
tatttttgtggtggatgtagagcaaaaatgaaagtgaaaagagttgctttca |
183 |
Q |
| |
|
||||||||| ||| || ||||||||||| |||||||||||||||||||||| |
|
|
| T |
2758868 |
tatttttgtcgtgtgtgaagagcaaaaataaaagtgaaaagagttgctttca |
2758919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 131 - 183
Target Start/End: Complemental strand, 27952976 - 27952924
Alignment:
| Q |
131 |
gtatttttgtggtggatgtagagcaaaaatgaaagtgaaaagagttgctttca |
183 |
Q |
| |
|
|||||||||||||| || | || ||||||||||||||||||||||| ||||| |
|
|
| T |
27952976 |
gtatttttgtggtgtgtgaaaaggaaaaatgaaagtgaaaagagttgttttca |
27952924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University