View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13061_low_72 (Length: 251)
Name: NF13061_low_72
Description: NF13061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13061_low_72 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 9 - 227
Target Start/End: Original strand, 48206551 - 48206774
Alignment:
| Q |
9 |
gacatcatcaatttttcaactactactttgtattttttatctnnnnnnnnt-----tgaatgggaaactttggatttggattgactgcacttgagttcct |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48206551 |
gacatcatcaatttttcaactactactttgtattttttatctaaaaaaaatataattgaatgggaaactttggatttggatttactgcacttgagttcct |
48206650 |
T |
|
| Q |
104 |
tgcagttaggtgcaatcatgtatattttgtgacagaggagtgtcttttgggcaagagagaatacatatttcaaacaaaaataatatactcagggaaaact |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48206651 |
tgcagttaggtgcaatcatgtatattttgtgagagaggagtgtcttttgggcaagagagaatacatatttcaaacaaaaataatatactcaggggaaact |
48206750 |
T |
|
| Q |
204 |
ttgtgtgtagacttcagaaactgc |
227 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
48206751 |
ttgtgtgtagacttcagaaactgc |
48206774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University